View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17683_high_3 (Length: 420)
Name: NF17683_high_3
Description: NF17683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17683_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 22 - 401
Target Start/End: Complemental strand, 40790919 - 40790540
Alignment:
| Q |
22 |
gtaagataattaaggatcttttacaatatgcctttgcatattatatggacccttctcccacgtatggccacatctacatatatatgaagnnnnnnnncat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
40790919 |
gtaagataattaaggatcttttacaatatgcctttgcatattatatggacccttctcccacgtatggccacaactacatatatatgaagaaaaaaaacat |
40790820 |
T |
 |
| Q |
122 |
gaatggaatttttagcactgaagtgagaaagaatctttagtattttgatcgatgaccccatctatcgatcatgattgattgagatcattatatggtcttc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40790819 |
gaatggaatttttagcactgaagtaagaaagaatctttagtattttgattgatgaccccatctatctatcatgattgattgagatcattatatggtcttc |
40790720 |
T |
 |
| Q |
222 |
acaaagttgtacacaatttcaagctttcaattcttgtattttatacggatataatttcttataagtcacagaaattggaattgatcttctttttcacttg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40790719 |
acaaagttgtacacaatttcaagctttcaattcttgtattttatacggatataatttcttataagtcacagaaattggaattgatcttctttttcacttg |
40790620 |
T |
 |
| Q |
322 |
ctcatgaaatttattatctcttttttaaaatctagtatttttgtctcttgttgaaatctttgttatgaaagtgatatgtc |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40790619 |
ctcatgaaatttattatctcttttttaaaatctagtatttttgtctcttgttgaaatctttgttatgaaagtgatatgtc |
40790540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University