View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17683_low_11 (Length: 225)
Name: NF17683_low_11
Description: NF17683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17683_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 50471051 - 50471258
Alignment:
| Q |
1 |
agtaaaagcataaagtttttgaaaagaacactttcaatgtccgaacgggaaggaggaggatcaaacaacgcagttcctaaaggctacctagccgtttgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50471051 |
agtaaaagcataaagtttttgaaaagaacactttcaatgtccgaacgggaaggaggaggatcaaacaacgcagttcctaaaggctacctagccgtttgtg |
50471150 |
T |
|
| Q |
101 |
ttggtgtagaccttaacaggtttgttataccaaccgagtatttggctcatcaagcctttcatatattactcagagaagccgaagaagaatttgggtttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50471151 |
ttggtgtagaccttaacaggtttgttataccaaccgagtatttggctcatcaagcctttcatatattactcagagaagctgaagaagaatttgggtttga |
50471250 |
T |
|
| Q |
201 |
acaaactg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
50471251 |
acaaactg |
50471258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 204
Target Start/End: Complemental strand, 1197116 - 1197001
Alignment:
| Q |
89 |
tagccgtttgtgttggtgtagaccttaacaggtttgttataccaaccgagtatttggctcatcaagcctttcatatattactcagagaagccgaagaaga |
188 |
Q |
| |
|
|||| ||||||||||| | ||| ||||| ||||| | |||||||| || ||||||| ||||||||| ||||| || | | |||||||| |||||||| |
|
|
| T |
1197116 |
tagctgtttgtgttggagaagagcttaagaggttcatcataccaactgaatatttgggtcatcaagcttttcagattcttttgagagaagctgaagaaga |
1197017 |
T |
|
| Q |
189 |
atttgggtttgaacaa |
204 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
1197016 |
atttgggtttcaacaa |
1197001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University