View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17684_high_13 (Length: 308)
Name: NF17684_high_13
Description: NF17684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17684_high_13 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 171 - 308
Target Start/End: Original strand, 47037019 - 47037156
Alignment:
| Q |
171 |
tcttgatggtccctactcataaaaaacaaatggaatggtaagctccaaaacactctttgagattgagcactactattctttcacctgtctcgctcattct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037019 |
tcttgatggtccctactcataaaaaacaaatggtatggtaagctccaaaacactctttgagattgagcactactattctttcacctgtctcgctcattct |
47037118 |
T |
|
| Q |
271 |
acatatcaacaactgcctcttttggtgcttatctcaat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037119 |
acatatcaacaactgcctcttttggtgcttatctcaat |
47037156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 3 - 107
Target Start/End: Original strand, 47036850 - 47036954
Alignment:
| Q |
3 |
tggaggagcagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattcttt |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036850 |
tggaggagaagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattcttt |
47036949 |
T |
|
| Q |
103 |
ttcat |
107 |
Q |
| |
|
||||| |
|
|
| T |
47036950 |
ttcat |
47036954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University