View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17687_high_18 (Length: 225)
Name: NF17687_high_18
Description: NF17687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17687_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 4203405 - 4203184
Alignment:
| Q |
1 |
cctgtcgtcctcccgcactagattctccaatggtactgtttcccaaggactttgtctgaagtgctaacttgttgattggttcccacgtcgctgttctgct |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
4203405 |
cctgtcgtcctcctgcactagattctccaatggaactgtttcccaaggactttgtctgaagtgctaacttgttgattggttcccacgtcgcggttctgtt |
4203306 |
T |
|
| Q |
101 |
tcttggatggcttttagcgaaactg-ccccttcattcatcctaacagtacccttatttatcaaaaaattcttctaatcaattatttgggcatagtccatc |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4203305 |
tcttggatggcttttagcgaaactgcccccttcattcatcctaacagtacccttatttatcaaaaaattcttctgatcaattatttgggcatagtccatc |
4203206 |
T |
|
| Q |
200 |
atctctggtaaggagtttactg |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4203205 |
atctctggtaaggagtttactg |
4203184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University