View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17687_low_20 (Length: 215)
Name: NF17687_low_20
Description: NF17687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17687_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 36427706 - 36427514
Alignment:
| Q |
11 |
agtagcatagggagtaccttaactttgatgtctttcttggaaatacgtgtcttacatgttttagtaagagtaaatattgaactgttttgaaattttggta |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36427706 |
agtaacatagggagtaccttaactttgatgtctttcttggaaatacgtgtcttacatgttttagtaagagttaatattgaactgttttgaaattttggta |
36427607 |
T |
 |
| Q |
111 |
tcctttttcaaaatacactctttcgtcaaatttgtacctctaattattttacctattttttgaaatgaataagtaaacaataagagtacacct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36427606 |
tcctttttcaaaatacactctttcgtcaaatttgtacctctaattattttacctattttttgaaatgaataagtaaacaataagagtacacct |
36427514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University