View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_high_15 (Length: 325)
Name: NF17688_high_15
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 120 - 308
Target Start/End: Complemental strand, 29421543 - 29421355
Alignment:
| Q |
120 |
cgtactcctgcagtttggtgctaaaaagtaaaccagttgcatgtttattttatgaacaccacttgcaatttttataattatagcatggatcgtgaggaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
29421543 |
cgtactcctgcagtttggtgctaaaaagtaaaccagttgcatgtttattttatgaacaccacttgcaatttttataactttagcatggatcgtgaggaat |
29421444 |
T |
|
| Q |
220 |
taaaaaattatattatttgtcaaagaagttcagatgtaccatttctttaaatgaaacaattcaaaacaaaaccaacctaatccataagt |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29421443 |
taaaaaattatattatctgtcaaagaagttcagatgtaccgtttctttaaatgaaacaattcaaaacaaaaccaacctaatccataagt |
29421355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 29421659 - 29421611
Alignment:
| Q |
4 |
gtaggaattttccgcgtgtgtttatttgagtatgagtttgtcattaatt |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29421659 |
gtaggaattttccgcgtgtgtttatttgagtatgagtttgtcattaatt |
29421611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University