View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17688_high_26 (Length: 226)

Name: NF17688_high_26
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17688_high_26
NF17688_high_26
[»] chr5 (2 HSPs)
chr5 (22-91)||(12559023-12559092)
chr5 (158-209)||(12559159-12559211)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 12559023 - 12559092
Alignment:
22 aaggaataacaattgtctacgtacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat 91  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
12559023 aaggaataacaattgtctacttacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat 12559092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 12559159 - 12559211
Alignment:
158 ggaacacatacaagtttgaatttaggaaa-ttgacgtcgttagtaattgattt 209  Q
    ||||||||||||||||||| ||||||||| |||||| ||||||||||||||||    
12559159 ggaacacatacaagtttgagtttaggaaatttgacgccgttagtaattgattt 12559211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University