View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_low_10 (Length: 387)
Name: NF17688_low_10
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_low_10 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 387
Target Start/End: Complemental strand, 15097227 - 15096855
Alignment:
| Q |
18 |
acaagatggtaaaatcactgaaatggcagcaatatattgtttctattcactacctgatcttttgacaaatactttgttacaacctttgagagtgttttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15097227 |
acaagatggtaaaatcactgaaatggcagcaatatattgtttctattcactacctgatcttttaacaaatactttgttacaacctttgagagtgttttta |
15097128 |
T |
|
| Q |
118 |
aggtcacaaaaagtgacaaaacccatgatgtattgctcccttatagcagttctttttcatgtgcctttgaattacttcttggttatggtgatgcaatttg |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15097127 |
aggtcacaaaaagtgacaaaacctatgatgtattgctcccttatagcagttctttttcatgtgcctttgaattatttcttggttatggtgatgcaatttg |
15097028 |
T |
|
| Q |
218 |
gagtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggttgtattgatggcggggtatgtcggcttgtttaggaagaaggagatgatgtt |
317 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15097027 |
gtgtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggtcgtgttgatggcggggtatgtcgggttgtttaggaagaaggagatgatgtt |
15096928 |
T |
|
| Q |
318 |
aaagtggcccggct---gcggcggtggcggagggatgatggttgtgagtgaaggtttgggggagttgatgaaa |
387 |
Q |
| |
|
||| ||||| || | ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
15096927 |
aaaatggccgggttgtggcggcggtggcggagggatgatggtggttagtgaaggtttgggggagttgatgaaa |
15096855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University