View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_low_23 (Length: 248)
Name: NF17688_low_23
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 35 - 229
Target Start/End: Complemental strand, 48665164 - 48664970
Alignment:
| Q |
35 |
atactcccagattgatgctaggagaacaaagccaagctgcaagaggatatagtttgacaaattatatgcaagtacagagggagggacttatttaaagtcc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48665164 |
atactcccagattgatgctaggagaacaaagccaagctgcaagaggatatagtttgacaaattatatgcaagtacagagggagggacttatttaaagtcc |
48665065 |
T |
 |
| Q |
135 |
aagattatgtaaaacaaagcataaaaaatataacactgaaataggtgataggaacttatcttaccactatccttattgtgatggagactgcatat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48665064 |
aagattatgtaaaacaaagcataaaaaatataacactgaaataggtgataggaacttatcttaccactatccttattgtgatggagactgcatat |
48664970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University