View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_low_24 (Length: 245)
Name: NF17688_low_24
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 42195059 - 42194854
Alignment:
| Q |
13 |
aatatcaaaaatgaaagggggtaagcgcttccacaaccctagctgtgagacatgaagg-tttttgatgtctct-gacactgcaaccacagcccttaatag |
110 |
Q |
| |
|
||||||||||| |||| |||| || |||| || ||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
42195059 |
aatatcaaaaacgaaaaggggcaatcgctaccgcaaccctagctgtgagacatgaaggattttttatgtctcttgacactgcaaccacagcccttaatag |
42194960 |
T |
|
| Q |
111 |
agtaatatagcacagctagccaaacaatgtcttaaccttgtaactaactgtgcaagcagaatactggtactacatagccaaacaagaccatgttcgtata |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||| |||| |
|
|
| T |
42194959 |
agtaatatagcacagctagccaaaaaatgtcttaaccttgtaactaactgtgcaagcagaatactggtactacagagcgaaacaaaaccatgttcctata |
42194860 |
T |
|
| Q |
211 |
actaac |
216 |
Q |
| |
|
|||||| |
|
|
| T |
42194859 |
actaac |
42194854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University