View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_low_29 (Length: 226)
Name: NF17688_low_29
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 12559023 - 12559092
Alignment:
| Q |
22 |
aaggaataacaattgtctacgtacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat |
91 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559023 |
aaggaataacaattgtctacttacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat |
12559092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 12559159 - 12559211
Alignment:
| Q |
158 |
ggaacacatacaagtttgaatttaggaaa-ttgacgtcgttagtaattgattt |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
12559159 |
ggaacacatacaagtttgagtttaggaaatttgacgccgttagtaattgattt |
12559211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University