View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_low_31 (Length: 217)
Name: NF17688_low_31
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 202
Target Start/End: Complemental strand, 52714106 - 52713914
Alignment:
| Q |
10 |
tgagatgaaaagcccaacgcccattcgttgtaacgatgtgatgccacggtggtggccggtaaacttacggagaaatgggattatgaatctctcgtagaaa |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52714106 |
tgagatgaaaagcccaacacccattcgttgtaacgatgtgatgccacggtggtggccggtaaacttacggagaaatgggattatgaatctctcgtagaaa |
52714007 |
T |
 |
| Q |
110 |
ggtacaagtatgaggccgttgatggcaccaaagacggggacagaacctgtcgggatttcgaagttgtttcctagttttctattcatgatgctg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52714006 |
ggtacaagtatgaggccgttgatggcaccaaagacggggacagaacctgtcgggatttcgaagttgtttcctagttttctattcatgatgctg |
52713914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 10 - 202
Target Start/End: Complemental strand, 52723128 - 52722936
Alignment:
| Q |
10 |
tgagatgaaaagcccaacgcccattcgttgtaacgatgtgatgccacggtggtggccggtaaacttacggagaaatgggattatgaatctctcgtagaaa |
109 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| || ||||||||||||||||| ||||||||||||| | |
|
|
| T |
52723128 |
tgagataaaaagcccaacacccattcgttgtaacgatgtgatgccacggtgatggcctgtaaatttgcggagaaatgggattattaatctctcgtagaga |
52723029 |
T |
 |
| Q |
110 |
ggtacaagtatgaggccgttgatggcaccaaagacggggacagaacctgtcgggatttcgaagttgtttcctagttttctattcatgatgctg |
202 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52723028 |
ggtacaagtatgaggccgttgatggcagcaaagacagggacagaacctgttgggatttcgaacttgtttcctagttttctattcatgatgctg |
52722936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 17 - 171
Target Start/End: Complemental strand, 52699822 - 52699668
Alignment:
| Q |
17 |
aaaagcccaacgcccattcgttgtaacgatgtgatgccacggtggtggccggtaaacttacggagaaatgggattatgaatctctcgtagaaaggtacaa |
116 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||||| ||| |||||||||||| || ||||||| ||||||||| |||||||| || || |||| || |
|
|
| T |
52699822 |
aaaagtccaactcccattcgttgtaaggatgtgatgccgcggctgtggccggtaaattttcggagaattgggattataaatctctcatataagggtataa |
52699723 |
T |
 |
| Q |
117 |
gtatgaggccgttgatggcaccaaagacggggacagaacctgtcgggatttcgaa |
171 |
Q |
| |
|
||||||| | | || ||||| |||| |||| ||||| || | ||||||||||| |
|
|
| T |
52699722 |
gtatgagactgctgctggcagcaaacacggtaacagatccatttgggatttcgaa |
52699668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University