View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_low_32 (Length: 212)
Name: NF17688_low_32
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_low_32 |
 |  |
|
| [»] scaffold0205 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0205 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 167
Target Start/End: Original strand, 17743 - 17897
Alignment:
| Q |
13 |
ataattcttgaatctgatgtagctgaagttaagtcttctgtaatttggcaatgttcgctatctgctatgccttgtaatgcagaaacaacctgaaattttg |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17743 |
ataattctagaatctgatgtagctgaagttaagtcttctgtaatttggcaatgttcgctatctgctatgccttgtaatgcagaaacaacctgaaattttg |
17842 |
T |
 |
| Q |
113 |
ccaaatgtacaattttattttgcaaagaaatcgaaacgagtcacttcacttctct |
167 |
Q |
| |
|
||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17843 |
ccagatgtacaattttatcttgcaaagaaatcgaaacgagtcacttcacttctct |
17897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University