View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17688_low_5 (Length: 497)
Name: NF17688_low_5
Description: NF17688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17688_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 360; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 18 - 427
Target Start/End: Complemental strand, 41468295 - 41467886
Alignment:
| Q |
18 |
acagaaccaggaacaggaacagcaacagcaccaggtgcaagaccaagaattcttgtatatcttccaacaaaccaagtcattcattccttctctcaacttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468295 |
acagaaccaggaacaggaacagcaacagcaccaggtgcaagaccaagagttcttgtatatcttccaacaaaccaagtcattcattccttctctcaacttg |
41468196 |
T |
 |
| Q |
118 |
agcaacgactcactgaacttggttggactcgttactctcactctcatcttccagaccacatccagtttcatcgttcagacacatctccacaccttctatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468195 |
agcaacgactcactgaacttggttggactcgttactctcactctcatcttccagaccacatccagtttcatcgttcagacacatctccacaccttctatc |
41468096 |
T |
 |
| Q |
218 |
actcccaagaaacttcagtagttttaagcactttcatatgtacgacattgttattcaaaaccgttcnnnnnnncaagttcgtgaccctacttcttagttc |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41468095 |
actcccaagaaacttcaatagttttaagcactttcatatgtacgacattgttattcaaaaccgttctttttttcaagttcgtgaccctacttcttagttc |
41467996 |
T |
 |
| Q |
318 |
ttactactaagcctatacgtagcttcattttgtcttttatcatcatcttgatcgtgcattgttagttagctaggnnnnnnnttcctcttgccctatgttc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41467995 |
ttactactaagcctatacgtagcttcattttgtcttttatcatcatcttgatcgtgcattgttagttagctaggaaaaaaattcctcttgccctatgttc |
41467896 |
T |
 |
| Q |
418 |
ctgccctagc |
427 |
Q |
| |
|
|||||||||| |
|
|
| T |
41467895 |
ctgccctagc |
41467886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 481
Target Start/End: Complemental strand, 41467865 - 41467826
Alignment:
| Q |
444 |
acatgcatatttt--gatgaacaagtagtacatgaattat |
481 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41467865 |
acatgcatattttttgatgaacaagtagtacatgaattat |
41467826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University