View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17689_low_4 (Length: 540)
Name: NF17689_low_4
Description: NF17689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17689_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 466; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 466; E-Value: 0
Query Start/End: Original strand, 18 - 531
Target Start/End: Original strand, 8173196 - 8173709
Alignment:
| Q |
18 |
catggattaggcttgtatcgttcccccctcttcaaatgccaccttgtcctcaaggtggaaggatggaaaagcagcctggaactgcacaaaatcttcccat |
117 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8173196 |
catggattgggcttgtatcattcccccctcttcaaatgccaccttgtcctcaaggtggaaggatggaaaagcagcctggaactgcacaaaatcttcccat |
8173295 |
T |
 |
| Q |
118 |
gaggcttcatccgggggacaattagcccgctgcacgagaacttgctgttgtggaacaccattgaccaaaacagtacgagtggaagcaatggctacaggga |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8173296 |
gaggcttcatccggtggacaattagcccactgcacgagaacttgctgttgtggaacaccattgaccaaaacagtacgagtggaagcaatggctacaggga |
8173395 |
T |
 |
| Q |
218 |
cctcaacaggtttggttagagatattgtctggaggtagaacatgagggaatggtaacgcagatccgcgaaatggtttcaagtttggaacataaaaaactg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8173396 |
cctcaacaggtttggttagagatattgtttggaggtagaacatgagggaaaggtaacgcagatccgcgaaatggtttcaagtttgaaacataaaaaactg |
8173495 |
T |
 |
| Q |
318 |
gatggatacgaatctctggtggcaactgaagtcggtaagccactttgaaaatgcattcgaggatctcaagaggcacataaaatttcttcgatagtttctg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8173496 |
gatggatacgaatctctggtggcaactgaaatcagtaagccactttgcaaatgcattcgaggatctcaagaggcacataaaatttcttcgatagtttctg |
8173595 |
T |
 |
| Q |
418 |
ttggtgttgttgtcgaacttagatctgtcggtgaggctttaaacgaaccagtatcaagtctcctacatcaaactgtaagtcacgacaatgtgcattggcc |
517 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8173596 |
ttggtgttgttgtcgaacttagatctgtcggtgaggctttaaacgaaccagtaccaagtctcctacatcaaactgtaagtcacgacagtgtgcattggcc |
8173695 |
T |
 |
| Q |
518 |
tgctgaaccatctg |
531 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8173696 |
tgctgaaccatctg |
8173709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University