View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1768_high_13 (Length: 240)
Name: NF1768_high_13
Description: NF1768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1768_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 3293859 - 3293635
Alignment:
| Q |
1 |
aatatcaatttccaccatggttttcacctgaatcaaagagattaatctcgaagattcttgtggcagatcctgaaagaagaatcactatttcttcaatcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3293859 |
aatatcaatttccaccatggttttcacctgaatcaaagagattaatctctaagattcttgtggcggatcctgaaagaagaatcactatttcttcaatcat |
3293760 |
T |
 |
| Q |
101 |
gaatgttccatggtttcagaaaggtttatgtttatcaacaactacta---caaatgatgatttggagttggattcaaaggtgaatttgattaactcaacg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3293759 |
gaatgttccatggtttcagaaaggtttatgtttatcaacaactactactgcaaatgatgatttcgagttggaatcaaaggtgaatttgattaactcaacg |
3293660 |
T |
 |
| Q |
198 |
ccgcaatttttcaatgcattcgagt |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3293659 |
ccgcaatttttcaatgcattcgagt |
3293635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University