View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1768_low_11 (Length: 256)
Name: NF1768_low_11
Description: NF1768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1768_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 30249830 - 30250086
Alignment:
| Q |
1 |
ccgacccaatatcaagaatacaatgtctagttttcgattatccgataaagcagccatgggtgaattatcctgcattggctaatattgtaacttatttgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30249830 |
ccgacccaatatcaagaatacaatgtctagttttagattatctgataaagcagccatgggtgaattatcctgcattggctaatattgtaacatatttgcc |
30249929 |
T |
 |
| Q |
101 |
acaacttagatgcatgtttgccttaaccggtaggattgaagactccttgactggtagtgagttaaaatgtatgcacgacgtaccatgaaagaatgcc--- |
197 |
Q |
| |
|
||||||| ||||||||| |||||||| | ||||| |||||||| |||||||| ||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
30249930 |
acaactt-gatgcatgtgtgccttaatccgtaggtttgaagacaccttgactagtagtgagttaaaatgtctccacaacgtaccatgaaagaatgcctaa |
30250028 |
T |
 |
| Q |
198 |
--tatatgacaacatcacactatcgacatctaattctatatttgtttcatctctctcg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30250029 |
gatatatgacaacatcacactatcgacatctaattctatatttgtttgttctctctcg |
30250086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University