View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1768_low_13 (Length: 251)
Name: NF1768_low_13
Description: NF1768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1768_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 10313122 - 10312900
Alignment:
| Q |
14 |
agacaaaaaccagcgtcctttgcattttgtgatagaaattttggcggtaagattctatgacgcatatcaaacatcacagttgaatgtgcttccaatgact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10313122 |
agacaaaaaccagcgtcctttgcattttgtgatagaaattttggcggtaagattctatgacgcatatcaaacatcacagttgaatgtgcttccaatgact |
10313023 |
T |
|
| Q |
114 |
caatattgcacagcaactgtgagaagcatccactaaaatgttaacaaaataggttatgaataattatagggtgatgatctaaaaactgagaagcaactca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10313022 |
caatattgcacagcaactgtgagaagcatccactaaaatgttaacaaaataggttatgaataattatagggtgatgatctaaaaactgagaagcaactca |
10312923 |
T |
|
| Q |
214 |
atagttaaaaatgatagcataat |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10312922 |
atagttaaaaatgatagcataat |
10312900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University