View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1768_low_17 (Length: 216)
Name: NF1768_low_17
Description: NF1768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1768_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 36079800 - 36079605
Alignment:
| Q |
1 |
cttgcacgtgtgacacatgcagggattttacaattgcaagaggttttggtgctgttggtgatgaaaatctgttgttgtatgtgtgcatgtgtaagatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36079800 |
cttgcacgtgtgacacatgcagggatgttacaattgcaagaggttttggtgctgttcgtgatgaaaatctgttgttgtatgtgtgcatgtgtaagatgga |
36079701 |
T |
|
| Q |
101 |
taagaatgaggagttttttggagtgtaaatggcgttggatgcaggatatgaaggtggagaatggtttgaaagacattggaaaaagttctcaagggg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36079700 |
taagaatgaggagttttttggagtgtaaatggcgttggatgcaggatatgaaggtggagaatggtttgaaagacattggaaaaagttctcaagggg |
36079605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University