View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1768_low_4 (Length: 375)
Name: NF1768_low_4
Description: NF1768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1768_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 50 - 370
Target Start/End: Complemental strand, 29078342 - 29078022
Alignment:
| Q |
50 |
gttgtaattgtcatgaactatatacaatagaagcaaaccacgataagggaccatttctaaaaataatttcacaattataattagatagtgcaagtagatc |
149 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29078342 |
gttgtaattgtcaagaactatatacaatagaagcaaaccacgataagggaccatttctaaaaataatttcacaattataattagatagtgcaagtagatc |
29078243 |
T |
|
| Q |
150 |
caatttcaatttatgcagctacagtataaatattggagctatctcaaactatttaatgaaagaaacaatatgggtcgttctgtctagtaggggaatatca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29078242 |
caatttcaatttatgcagctacagtataaatattggagctatctcaaactatttaatgaaagaaacaatatgggtcgttctgtctagtaggggaatatca |
29078143 |
T |
|
| Q |
250 |
tgaaatgggcttaaattaaaatcaaaatatgtgaccnnnnnnntgtccatataagggataggtggcacgtgtaattgttgtattgttgtgcttatggact |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29078142 |
tgaaatgggcttaaattaaaatcaaaatatgtgaccaaaaaaatgtccatataagggataggtggcacgtgtaattgttgtatggttgtgcttatggact |
29078043 |
T |
|
| Q |
350 |
gtcttatttgtctgtgctgct |
370 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
29078042 |
gtcttatttgtctgtgatgct |
29078022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University