View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17692_low_8 (Length: 255)
Name: NF17692_low_8
Description: NF17692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17692_low_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 17 - 255
Target Start/End: Original strand, 766319 - 766559
Alignment:
| Q |
17 |
atgaaaacggtgagttaattttcttatttccattcataaatctataaccaagtacaatgttccatttttattgtactagtttgtaacaatctaggtagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
766319 |
atgaaaacggtgagttaattttcttatttccattcataaatctataaccaagtacaatgttccatttttattctacttgtttgtaacaatctaggtagta |
766418 |
T |
|
| Q |
117 |
tctaaattctagattgaagatgtgttgggtgtctttca--------acacgatgatatgattgcattcaatcgattattttatttcaaaaattagtattc |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
766419 |
tctaaattttagattgaagatgtgttgggtgtctttcacgaaacacacacgaagatatgattgcattcaatcgattattttattttaaaaattagtattc |
766518 |
T |
|
| Q |
209 |
atgtgtatgtgttagtgttagtggtccgtgtcaattttttgtgcttc |
255 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
766519 |
atgtgtat------gtgttagtggtccgtgtcaattttttgtgcttc |
766559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University