View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17693_low_3 (Length: 262)
Name: NF17693_low_3
Description: NF17693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17693_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 247
Target Start/End: Complemental strand, 8532734 - 8532495
Alignment:
| Q |
9 |
aggctgggcaggttccaatggcatatgtggtaaggaatgtgggaagtaacttgtccggaaggcaagttatggattttgttgcagagcaggtttgtttgtt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8532734 |
aggctgggcaggttccaatggcatatgtggtaaggaatgtgggaagtaacttgtccggaagccaagttatggattttgttgcagagcaggtttgtttgtt |
8532635 |
T |
 |
| Q |
109 |
tcaaacatttctcaacaatgacactctttattagatgcttgggttttgatttcaactatgagattgaaaactaaattattatt-ttttcaatatataggt |
207 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8532634 |
tgaaacatttctcaacaatgacactctttattagatgcttgggttttgatttcaactatgagattgaaaactaaattattatttttttcaatatataggt |
8532535 |
T |
 |
| Q |
208 |
ggctccatacaaaagaattcgaaaagtggcatttatatct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8532534 |
ggctccatacaaaagaattcgaaaagtggcatttatatct |
8532495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 9 - 106
Target Start/End: Complemental strand, 14749747 - 14749650
Alignment:
| Q |
9 |
aggctgggcaggttccaatggcatatgtggtaaggaatgtgggaagtaacttgtccggaaggcaagttatggattttgttgcagagcaggtttgtttg |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| | ||||||||| | || | ||| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
14749747 |
aggctgggcagtatccaatggcatatgtggtaaggaaggatggaagtaacatatcagaaagccaagttatggaatttgttgcaggccaggtttgtttg |
14749650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University