View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17694_low_2 (Length: 225)
Name: NF17694_low_2
Description: NF17694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17694_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 81 - 134
Target Start/End: Complemental strand, 9262622 - 9262568
Alignment:
| Q |
81 |
tttcttcatcttctttcc-tcttctccttcgtcattttcaacataatcttcatac |
134 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9262622 |
tttcttcatcttctttccctcttctccttcgtcattttcaacataatcttcatac |
9262568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 51
Target Start/End: Complemental strand, 9262681 - 9262634
Alignment:
| Q |
4 |
aaaaatacaagcatcaaaaatctattaaattataatcatcagcaacta |
51 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
9262681 |
aaaaatgcaagcataaaaaatctattaaattataatcatcaacaacta |
9262634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 134
Target Start/End: Complemental strand, 44752365 - 44752317
Alignment:
| Q |
86 |
tcatcttctttcctcttctccttcgtcattttcaacataatcttcatac |
134 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
44752365 |
tcatcttcttccctcttcttcttcttcattttcatcataatcttcatac |
44752317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 134
Target Start/End: Complemental strand, 11437839 - 11437786
Alignment:
| Q |
81 |
tttcttcatcttctttcctcttctccttcgtcattttcaacataatcttcatac |
134 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
11437839 |
tttcttcatcttcttcccttctctcctttatcatcttcaacataatcttcatac |
11437786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University