View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17695_low_5 (Length: 291)
Name: NF17695_low_5
Description: NF17695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17695_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 276
Target Start/End: Complemental strand, 36808975 - 36808719
Alignment:
| Q |
20 |
ctctaacaaacctacaaatcttctgcgctagaagaccacaatggcccctatcatcgaatcgaaaattgcttcgactagtttccacactcgcattcaatct |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36808975 |
ctctaacaaacctacaaatcgtctgcgctagaagaccacaatggcccctatcgtcgaatcgaaaattgcttcaactagtttccacactcgcattcaatct |
36808876 |
T |
 |
| Q |
120 |
caagatcttgccagaaccctttaattccctcgtcggcaaaatcgcacaaaccaattcgaatgaacatcggattgtgaaccgtctcatcagtggctggagt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36808875 |
caagatcttgccagaaccctttaattccctcgtccgcgaaatcgcacaaaccaattcgaatgaacatcggattgtgaaccgtctcatcagtggctggagt |
36808776 |
T |
 |
| Q |
220 |
aggaaaacaaacaaatcgaacaagaggatgaatgagaagaagtttttgttgccattg |
276 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
36808775 |
aggaaaacaaacaaatcgagcaagaggaggaatgagcagatgtttttgttgccattg |
36808719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University