View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17697_high_11 (Length: 207)
Name: NF17697_high_11
Description: NF17697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17697_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 21 - 167
Target Start/End: Complemental strand, 47436473 - 47436327
Alignment:
| Q |
21 |
ttcttcactatcacactccatcnnnnnnntaatcacttctctctcaaaacctccttttgcttctactttcacttgcgtaacgctaactaactcttcttga |
120 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47436473 |
ttcttcactatcacactccatcaaaaaaataatcacttctctctcaaaatctccttttgcttctactttcacttgcgtaacgctaactaagtcttcttga |
47436374 |
T |
|
| Q |
121 |
gtgttcttttttcatcatctatggctatggaagcacttaactcacca |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436373 |
gtgttcttttttcatcatctatggctatggaagcacttaactcacca |
47436327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University