View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17697_high_11 (Length: 207)

Name: NF17697_high_11
Description: NF17697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17697_high_11
NF17697_high_11
[»] chr3 (1 HSPs)
chr3 (21-167)||(47436327-47436473)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 21 - 167
Target Start/End: Complemental strand, 47436473 - 47436327
Alignment:
21 ttcttcactatcacactccatcnnnnnnntaatcacttctctctcaaaacctccttttgcttctactttcacttgcgtaacgctaactaactcttcttga 120  Q
    ||||||||||||||||||||||       |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||    
47436473 ttcttcactatcacactccatcaaaaaaataatcacttctctctcaaaatctccttttgcttctactttcacttgcgtaacgctaactaagtcttcttga 47436374  T
121 gtgttcttttttcatcatctatggctatggaagcacttaactcacca 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
47436373 gtgttcttttttcatcatctatggctatggaagcacttaactcacca 47436327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University