View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17698_high_35 (Length: 230)
Name: NF17698_high_35
Description: NF17698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17698_high_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 12651881 - 12652099
Alignment:
| Q |
1 |
cttttcactttgagttacctcaatgtgtttccacttgcagtaacctcactgttcttaagttagggaaactgtccttaaattgtttgttggatgccaattt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12651881 |
cttttcacttcgagttacctcaatgtgtttccacttgcagtaacctcactgttcttaagttaaggaaactgtccttaaattgtttgttggatgccaattt |
12651980 |
T |
|
| Q |
101 |
tcccttactcgaaattcttaatttggatagaatcaaatttaacgtagatcacacttgctttcttgagaaccttctcaatggttgtcccgctttacaggat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12651981 |
tcccttactcaaaattcttaatttggatagaatcaaatttaatgtagatcacacttgctttcttgagaaccttctcaatggttgtcccgctttacaggat |
12652080 |
T |
|
| Q |
201 |
ttgagaataaatggttcat |
219 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
12652081 |
ttgagaataattggttcat |
12652099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 11377702 - 11377752
Alignment:
| Q |
8 |
ctttgagttacctcaatgtgtttccacttgcagtaacctcactgttcttaa |
58 |
Q |
| |
|
|||| |||||||||| ||||||| || ||||||||||||||||| |||||| |
|
|
| T |
11377702 |
ctttaagttacctcattgtgttttcagttgcagtaacctcactgctcttaa |
11377752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University