View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17698_high_39 (Length: 205)

Name: NF17698_high_39
Description: NF17698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17698_high_39
NF17698_high_39
[»] chr7 (1 HSPs)
chr7 (1-58)||(31294256-31294313)
[»] chr3 (1 HSPs)
chr3 (73-105)||(31620633-31620665)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 31294313 - 31294256
Alignment:
1 gtatcaagaactttcatataatcaaagacctttttataccatgaatatcaaatccttc 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31294313 gtatcaagaactttcatataatcaaagacctttttataccatgaatatcaaatccttc 31294256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 105
Target Start/End: Complemental strand, 31620665 - 31620633
Alignment:
73 aattcacggtagattagactattgattgcttag 105  Q
    |||||||||||||||||||||||||||||||||    
31620665 aattcacggtagattagactattgattgcttag 31620633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University