View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17698_low_29 (Length: 254)
Name: NF17698_low_29
Description: NF17698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17698_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 6023643 - 6023842
Alignment:
| Q |
10 |
ataattctgagacaatggtatacccccacgttaagaaagagtgtatttatagcttcatttgatgtttacttgtaccttccccctggtttgctctttaaca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6023643 |
ataattctgagacaatggtatacccccacgttaagaaagagtgtatttatagctttatttgttgtttacttgtaccttccccctggtttgctctttaaca |
6023742 |
T |
|
| Q |
110 |
tgactgattgatgacttatttttgtgtcattttgaccaacctttatacaacatcaccaagtttatctattgtctatctttatgaaatgcttgttatcttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6023743 |
tgactgattgatgacttatttttgtgtcattttgaccaacctttatacaacataaccaagtttatctattgtctatctttatgaaatgcttgttatcttt |
6023842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University