View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17698_low_33 (Length: 238)
Name: NF17698_low_33
Description: NF17698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17698_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 16647070 - 16646962
Alignment:
| Q |
1 |
caacgcaacatttgagtaacaatagcaatggaactgcaagtagttcgtatgaatatgagaatggggattgtgagtttgaagatgaggtgcatgagcatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16647070 |
caacgcaacatttgagtaacaatagcaatggaactgcaagtagttcgtatgaatatgagaat-gggattgttagtttgaagatgaggtgcatgagcatgt |
16646972 |
T |
 |
| Q |
101 |
tttttaagaa |
110 |
Q |
| |
|
|||| ||||| |
|
|
| T |
16646971 |
ttttgaagaa |
16646962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University