View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17698_low_39 (Length: 205)
Name: NF17698_low_39
Description: NF17698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17698_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 31294313 - 31294256
Alignment:
| Q |
1 |
gtatcaagaactttcatataatcaaagacctttttataccatgaatatcaaatccttc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31294313 |
gtatcaagaactttcatataatcaaagacctttttataccatgaatatcaaatccttc |
31294256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 105
Target Start/End: Complemental strand, 31620665 - 31620633
Alignment:
| Q |
73 |
aattcacggtagattagactattgattgcttag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31620665 |
aattcacggtagattagactattgattgcttag |
31620633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University