View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17699_high_14 (Length: 290)
Name: NF17699_high_14
Description: NF17699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17699_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 2 - 270
Target Start/End: Complemental strand, 48927118 - 48926850
Alignment:
| Q |
2 |
gtggaggagcagagaaaatttgaagggcatgtggttgctttggtgaagatgctgatgaagaagaacaagctgggaattgttgaggaagtgttggaagagt |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48927118 |
gtggtggagcagagaaaatttgaagggcatgtggttgctttggtgaagatgctgatgaagaagaacaagctgggaattgttgaggaagtgttggaagagt |
48927019 |
T |
|
| Q |
102 |
tcatgaggatttatgatgaattatgtggaactcaagttgttttggtttcatcaaaaagagaaattggagaagatgaaatgtttgggattgccaaaagtgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48927018 |
tcatgaggatttatgatgaattatgtggaactcaagttgttttggtttcatcaaaaagagaaattggagaagatgaaatgtttgggattgccaaaagtgt |
48926919 |
T |
|
| Q |
202 |
gcagaaactcagtggtgcagtgagggttaaggttaagaatttggttcaagaagagagttttccttcttc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48926918 |
gcagaaactcagtggtgcagtgagggttaatgttaagaatttggttcaagaagagagttttccttcttc |
48926850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University