View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17699_high_18 (Length: 242)
Name: NF17699_high_18
Description: NF17699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17699_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 10777843 - 10778043
Alignment:
| Q |
1 |
aaaaaatttgtataaattgaaatgaaaaattttgttttgtgatagctgggta-tgagacccttgatgtgatttagatgtgagctcgacaaaggttaatct |
99 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10777843 |
aaaaaagttgtataaattgaaatgaaaaattttgttttgtgatagcagggtaatgagaccctagatgtgatttagatgtgagctcgacaaaggttaatct |
10777942 |
T |
|
| Q |
100 |
ggtcctatgtatctttaatgatcttagagaattagagctaccnnnnnnngtgtatatttatctcttcnnnnnnnggatactaatggtaggagccacaacc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10777943 |
ggtcctatgtatctttaatgatcttagagaattagagctacctttttttgtgtatatttatctcttcaaaaaaaggatactaatggtaggagccacaacc |
10778042 |
T |
|
| Q |
200 |
c |
200 |
Q |
| |
|
| |
|
|
| T |
10778043 |
c |
10778043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University