View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17699_high_21 (Length: 215)
Name: NF17699_high_21
Description: NF17699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17699_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 2 - 199
Target Start/End: Complemental strand, 41700794 - 41700597
Alignment:
| Q |
2 |
aaacactaatttgaaacaattccaaaagggcagtggccggctcacgacccgtgcatcctagtacctggtatgtgtgcctaactacgaatcataattttga |
101 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41700794 |
aaacactaatttaaaacaatttcaaaagggcagtggctggctcacgacccgtgcatcctagtacctggtatgtgtgcctaactacgaatcataattttta |
41700695 |
T |
 |
| Q |
102 |
aggtcaaggactagcacaatctgtgcgttgaggcacacggctcgtgtgccttgtatcgaaccaaattggttgttacaaacctttgaaattctcttttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41700694 |
aggtcaaggactagcacaatctgtgcgttgaggcacacgactcgtgtgccttgtatcgaaccaaattggttgttacaaatctttgaaattctcttttt |
41700597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 195
Target Start/End: Original strand, 12521009 - 12521045
Alignment:
| Q |
159 |
gaaccaaattggttgttacaaacctttgaaattctct |
195 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
12521009 |
gaaccaaaatggttgttacaaacttttgaaattctct |
12521045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University