View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17699_low_16 (Length: 268)
Name: NF17699_low_16
Description: NF17699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17699_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 35787100 - 35786958
Alignment:
| Q |
19 |
agttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787100 |
agttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatg |
35787001 |
T |
 |
| Q |
119 |
atcgtgctgctattattctctatggttctagggctcagcttaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787000 |
atcgtgctgctattattctctatggttctagggctcagcttaa |
35786958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 54
Target Start/End: Complemental strand, 25896674 - 25896641
Alignment:
| Q |
21 |
ttggggtaaatgggttgctgaaattcgtgaacca |
54 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
25896674 |
ttggggtaaatgggttgctgagattcgtgaacca |
25896641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 53
Target Start/End: Original strand, 52690554 - 52690586
Alignment:
| Q |
21 |
ttggggtaaatgggttgctgaaattcgtgaacc |
53 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
52690554 |
ttggggtaaatgggttgctgaaatccgtgaacc |
52690586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University