View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17699_low_22 (Length: 214)
Name: NF17699_low_22
Description: NF17699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17699_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 44779426 - 44779606
Alignment:
| Q |
12 |
aagcataggtgatgcaaagaaattttctcaacaattgttgaaagcaaaaaataccattgcaaaattattagtgtcatttgtgtgatgccgaatgcgaaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44779426 |
aagcataggtgatgcaaagaaattttctcaacaattgttgaaagcaaaaaataccattgcaaaattattagtgtcatttgtgtgatgccgaatacgaaag |
44779525 |
T |
|
| Q |
112 |
aatgaaacagataacggtgtttatggtaagttaaaaaatcaaataaaagggattgtgttaaatttctcaaaaattggtgggg |
193 |
Q |
| |
|
||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44779526 |
aattaaacatataacggtgtttatggt-agttaaaaaatcaaataaaagggattgtgttaaatttctcaaaaattggtgggg |
44779606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University