View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17699_low_24 (Length: 207)
Name: NF17699_low_24
Description: NF17699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17699_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 42903461 - 42903636
Alignment:
| Q |
18 |
gattggaacctgtgaaggtgaggaaggtttgatgatgaccatgaaatgctgcaaatcccaaatattaagggagtaagcagcagacataagcaattgtggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42903461 |
gattggaacctgtgaaggtgaggaaggtttgatgatgaccatgaaatgctgcaaatcccaaatattaagggagtaagcagcagacataagcaattgtggt |
42903560 |
T |
 |
| Q |
118 |
ggtccctttgaagcccttagaggcattgctgccacatacacttcctctctgcctcttaccattcttcttgcctttg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42903561 |
ggtccctttgaagcccttagaggcattgctgccacatacacttcctctctgcctcttaccattcttcttgtctttg |
42903636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 117 - 175
Target Start/End: Original strand, 42908538 - 42908596
Alignment:
| Q |
117 |
tggtccctttgaagcccttagaggcattgctgccacatacacttcctctctgcctctta |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42908538 |
tggtccctttgaagcccttagaggcattgctgccacatacacttcctctctgcctctta |
42908596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University