View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17700_low_3 (Length: 331)
Name: NF17700_low_3
Description: NF17700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17700_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 311
Target Start/End: Complemental strand, 45683674 - 45683376
Alignment:
| Q |
16 |
atggaaatatgaaaaacattttattttggttgatagctaacccaaatttaaacaccaacacgcaaggctacaacctaacaac---tttattaatatcaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45683674 |
atggaaatatgaaaaacattttattttggttgatagctaacccaaatttaaacaccaacacgcaaggctacaacctaacaacaactttattaatatcaat |
45683575 |
T |
 |
| Q |
113 |
gaggttatagtgttgtgtcaagttactctgattgtatgcaattatatatcagtacctaaaatatagcaactgatagcagttcataatattttcagcactt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683574 |
gaggttatagtgttgtgtcaagttactctgattgtaagcaattatatatcagtacctaaaatatagcaactgatagcagttcataatattttcagcactt |
45683475 |
T |
 |
| Q |
213 |
ttctaaatgtgtaatattcattcaataatcttcaggcattcttcagaaaggcaattgatgacatggctgcccagagcttgcgttgtattgctattgcat |
311 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683474 |
ttctaaatgtgtaatattcatttaataatcttcaggcattcttcagaaaggcaattgatgacatggctgcccagagcttgcgttgtattgctattgcat |
45683376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University