View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17700_low_7 (Length: 227)
Name: NF17700_low_7
Description: NF17700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17700_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 42343125 - 42342909
Alignment:
| Q |
5 |
aagactattataaaattaagtataaatttttatttcgtcgtaattataaaagtacttgtaaattcttcttttgtcaaaactatatgttccaaatccttga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42343125 |
aagactattataaaattaagtataaatttttatttcgtcgtaattataaaggtgcctgtaaattcttctttcttcaaaactatatgttccaaatccttga |
42343026 |
T |
|
| Q |
105 |
atcttagtcagccagagtatcgtgcttgtaacatgttttaaaataagatataaagaacatcattaaagatggagaagatgagaatttatgtattgttgtc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42343025 |
atcttagtcagccagagtatcgtgcttgtaacatgttttaaaataagatataaaaaacaacattaaagatggagtagatgagaatttatgtattgttgtc |
42342926 |
T |
|
| Q |
205 |
tttgtgagtgtgtcttt |
221 |
Q |
| |
|
|| || | ||||||||| |
|
|
| T |
42342925 |
ttcgtaaatgtgtcttt |
42342909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University