View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17701_high_16 (Length: 321)
Name: NF17701_high_16
Description: NF17701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17701_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 179 - 284
Target Start/End: Complemental strand, 42309552 - 42309447
Alignment:
| Q |
179 |
ctaaaatagataaaagagggtaaatggaaatattagtaccctgaaaccactacattgaaaactttggctttttcacaaaataaaaagtctcctagttggg |
278 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42309552 |
ctaaaatagataaaagaaggtaaatggaaatattagtaccctgaaaccactacattgaacactttggttttttcacaaaataaaaagtctcctagttggg |
42309453 |
T |
 |
| Q |
279 |
tcatga |
284 |
Q |
| |
|
|||||| |
|
|
| T |
42309452 |
tcatga |
42309447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 42309689 - 42309603
Alignment:
| Q |
30 |
aacagtccaagcaaatcataaactgcacaaagaaacagaggcaatgcaagatgaacatataaaattatattcctttctaaaagatag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42309689 |
aacagtccaagcaaatcataaactgcacaaagaaacagaggcaatgcaagatgaacatataaaattatattcctttctaaaagatag |
42309603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University