View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17702_low_12 (Length: 209)
Name: NF17702_low_12
Description: NF17702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17702_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 46939630 - 46939830
Alignment:
| Q |
1 |
ttggcatgtctgagaccaaaaccctcacttgaagtttttcaataacagaagacaatgtttcaatatgggacactgattttcttgcctcaacaaatttacc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939630 |
ttggcatgtctgagaccaaaaccttcacttgaagtttttcaataacagaagacaatgtttcaatatgggacactgattttcttgcctcaacaaatttacc |
46939729 |
T |
 |
| Q |
101 |
taccttttcttctgctgctaactttgtttcatcaacataagacactgattttcttccttcttcaactatgattcctctttttattgctggtgatgatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939730 |
taccttttcttctgctgctaactttgtttcatcaacataagacactgattttcttccttcttcaactatgattcctctttttattgctggtgatgatgat |
46939829 |
T |
 |
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
46939830 |
g |
46939830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University