View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17703_low_11 (Length: 219)
Name: NF17703_low_11
Description: NF17703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17703_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 55074896 - 55074713
Alignment:
| Q |
16 |
gattcaattagtaagtatccaatatccaacaaaaacatgtgtgtgtccaccctgagtccctgatcttgatgattccagatccaaatgattttcacatnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
55074896 |
gattcaattagtaagtatccaatatccaacaaaaacatgtgtgtgtccaccctaa--------tcttgatgattccagatccaaatgattttcacataaa |
55074805 |
T |
|
| Q |
116 |
nnnnn-tgatgggatgaaatattaggaaagaatatatataaatgcaaagaattgttcaactctgattatcccaaagcaacaatgagaataat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55074804 |
aaaaaatgatgggatgaaatattaggaaagaatatatataaatgcaaagaattgttcaactctgattatgccaaagcaacaatgagaataat |
55074713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University