View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17703_low_5 (Length: 315)
Name: NF17703_low_5
Description: NF17703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17703_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 53395962 - 53396248
Alignment:
| Q |
19 |
catgagttattgttcgatacaagctttgaaaattttgttgaagaattatttggggtgtgaagagggtgttgatttggatgactctgttttgaaggaattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53395962 |
catgagttattgttcgatacaagctttgaaaattttgttgaagaattatttggggtgtgaagagggtgttgatttggatgactctgttttgaaggaattg |
53396061 |
T |
|
| Q |
119 |
gaggaagttgttgaaatggcaaggatgacaccagctgatataagtgaggttttgattaagaatcggaggaagaaagagaaagctgtggatgaattgttgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53396062 |
gaggaagttgttgaaatggcaaggatgacaccagctgatataagtgaggttttgattaagaatcggaggaagaaagagaaagctgtggatgaattgttgg |
53396161 |
T |
|
| Q |
219 |
agattttgaaggtgagagcagagaggaatgcaaaaaatggtggtgttgtgaggagggaaaataatggggttggagatgaagatgatg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53396162 |
agattttgaaggtgagagcagagaggaatgcaaaaaatggtagtgttgtgaggagggaaaataatggggttggagatgaagatgatg |
53396248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 168 - 305
Target Start/End: Complemental strand, 18845894 - 18845757
Alignment:
| Q |
168 |
ttttgattaagaatcggaggaagaaagagaaagctgtggatgaattgttggagattttgaaggtgagagcagagaggaatgcaaaaaatggtggtgttgt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18845894 |
ttttgattaagaatcggaggaagaaagagaaagttgtggatgaattgttggagatattgaaggtgagagcagagaggaatgcaaaaaatggtggtcttgt |
18845795 |
T |
|
| Q |
268 |
gaggagggaaaataatggggttggagatgaagatgatg |
305 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
18845794 |
gaggagggaaaataatgggttgggagatgaagatgatg |
18845757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University