View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17704_high_16 (Length: 315)
Name: NF17704_high_16
Description: NF17704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17704_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 3151529 - 3151251
Alignment:
| Q |
19 |
cggaaatgataaaagtagcagtttcttcaacaaagccatttcctaaactcaaatgttctggagctacatctttgtccagtattccaccacaatagcattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| || ||||||||| ||||| |
|
|
| T |
3151529 |
cggaaatgataaaagtagcagtttcttcaacaaagccatttcctaaactcagatgttctggagccacatctttgtccagtactctaccacaataacattt |
3151430 |
T |
 |
| Q |
119 |
ttgattcctcatagtgctcaaaagattctcactttctcttctagtacactcccaatcactacagaagaagtactccattggtgtatcatcaatgttcagt |
218 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||| |
|
|
| T |
3151429 |
ttgattcctcatagtgctcaaaagactcccactttctcttctagtacactcccaatcactacagaagaagtactcaattggtgtgtcatcaatgtttagt |
3151330 |
T |
 |
| Q |
219 |
ttcatctgctggaaataaaattccgtggagttttcttggctgcagcagcatttctttgcatgcctgtgaccatagatatt |
298 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151329 |
ttcatctgctggaaataaatttccgtggag-tttcttggctgcagcagcatttctttgcatgcctgtgaccatagatatt |
3151251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University