View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17704_low_20 (Length: 303)
Name: NF17704_low_20
Description: NF17704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17704_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 15 - 282
Target Start/End: Complemental strand, 4997185 - 4996918
Alignment:
| Q |
15 |
aatagcattaccaagaaaattggtagcaagtgaaagattttggagtgttggaatatgacagaaattagatggaaaatcaccataaataccggtttctgtg |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997185 |
aatagcattaccaagaaaattcgtagcaagtgaaagattttggagtgttggaatatgacagaaattagatggaaaatcaccataaataccggtttctgtg |
4997086 |
T |
 |
| Q |
115 |
aggtcgattgatacaacggatttattccacgaatcgcaggttatgcctctccagttacaaggattatgatctgtgtttggaagccaatcattgagacttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997085 |
aggtcgattgatacaacggatttattccgcgaatcgcaggttatgcctctccagttacaaggattatgatctgtgtttggaagccaatcattgagacttt |
4996986 |
T |
 |
| Q |
215 |
tgtttttgtcatcaatttgtgtgttctttacatgaagaagaatttcatagtctcttgagagtgaaaag |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4996985 |
tgtttttgtcatcaatttgtgtgttctttacatgaagaagaatttcatagtctcttgagagtgaaaag |
4996918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University