View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17704_low_22 (Length: 285)
Name: NF17704_low_22
Description: NF17704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17704_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 270
Target Start/End: Original strand, 39821722 - 39821973
Alignment:
| Q |
20 |
atgacaacctagaagnnnnnnncgagaatcaacaatgtaggtgataaaaatgaaaggtag--tgtaggaggagttgtgtagtacagtctattgtttgtaa |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
39821722 |
atgacaacctagaagaaaaaaacgagaatcaacaatgtaggtgataaaaacgaaaggtagagtgtaggaggagttgtttagtacagtctattgtctgtaa |
39821821 |
T |
|
| Q |
118 |
tataacaaaaagcagaccgggtcgtaactcccgaatttgagagaacgggagttaagaccaaatgtaaaaataggttcataagtcccaataaggatatttt |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39821822 |
tataacaaaaagcagaccgg-tcgtaactcccgaatttgagagaacgggagttaagaccaaatgtaaaaataggttcataagtcccgataaggatatttt |
39821920 |
T |
|
| Q |
218 |
ggacattttgaggggactgtgagcaaatcaaggggtcgattgagcaattttct |
270 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39821921 |
ggacattttgaggggactgtgagcaaaccaaggggtcgattgagcaattttct |
39821973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University