View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17704_low_29 (Length: 246)
Name: NF17704_low_29
Description: NF17704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17704_low_29 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 34228806 - 34228580
Alignment:
| Q |
20 |
ttcgaggcatgaattacttcaatagcctccacgaaagcatattcttcatgagaaatacacttgtcaaggcagcatttcaatttgttagcaagaagtttgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34228806 |
ttcgaggcatgaattacttcaatagcctccacgaaagcatattcttcatgagaaatacacttgtcaaggcagcatttcaatctgttagcaagaagtttgg |
34228707 |
T |
|
| Q |
120 |
aaatcattttatacaatacgttacacaactagataggacacaaacccctcatggaaataggattttcacacttcggaataagccagatattcatctcatt |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34228706 |
aaatcattttatacaagacgttacacaactagataggacacaaatccctcatggaaataggattttcacacttcggaataagccagatattcatctcatt |
34228607 |
T |
|
| Q |
220 |
aaggttgtttgggaaaaatccatgatc |
246 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34228606 |
aaggttgtttgggaaaaatccatgatc |
34228580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University