View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17704_low_34 (Length: 219)
Name: NF17704_low_34
Description: NF17704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17704_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 8419366 - 8419556
Alignment:
| Q |
13 |
atgaagtgtgttggtgttacatagcttttggtgagataattgaacttttttggagttaattgtttattataaaatttaatttaagataataaaactgatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8419366 |
atgaagtgtgttggtgttacatagcttttggtgagataattgaacttttttggagttaattgtttattataaaatttaatttaagataataaaactgatt |
8419465 |
T |
 |
| Q |
113 |
gaatgtaattatgtgtcgatgtcgtgttggtctcaaatacttacggtgacacgtgtcagacactaggcatgtctttgatatgaagtgtgtg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8419466 |
gaatgtaattatgtgtcgatgtcgtgttggtctcaaatgcttacggtgaaatgtgtcagacactagacatgtctttgatatgaagtgtgtg |
8419556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 13 - 157
Target Start/End: Original strand, 8427852 - 8427993
Alignment:
| Q |
13 |
atgaagtgtgttggtgttacatagcttttggtgagataattgaacttttttggagttaattgtttattataaaatttaatttaagataataaaactgatt |
112 |
Q |
| |
|
|||| |||||||| ||||| || | |||| ||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8427852 |
atgatgtgtgttgttgttatatggttttttgtgagataattaaacttttttggaattaattgtttattata-----taatttaagataataaaaatgatt |
8427946 |
T |
 |
| Q |
113 |
gaatgtaa--ttatgtgtcgatgtcgtgttggtctcaaatacttacg |
157 |
Q |
| |
|
|| |||| ||||||| ||||| |||||||| | |||||||||| |
|
|
| T |
8427947 |
caacgtaactatatgtgtggatgttgtgttggtgacgaatacttacg |
8427993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 14 - 77
Target Start/End: Original strand, 8419680 - 8419741
Alignment:
| Q |
14 |
tgaagtgtgttggtgttacatagcttttggtgagataattgaacttttttggagttaattgttt |
77 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8419680 |
tgaagtgtgtcggtgctatatagcttttggtgagataattgaa--attttggagttaattgttt |
8419741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 61
Target Start/End: Complemental strand, 28705151 - 28705099
Alignment:
| Q |
9 |
tgagatgaagtgtgttggtgttacatagcttttggtgagataattgaactttt |
61 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||| | ||||||||| |||| |
|
|
| T |
28705151 |
tgagctgaagtgtgttggtgctatatagcttttggtcacataattgaattttt |
28705099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University