View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17704_low_35 (Length: 217)
Name: NF17704_low_35
Description: NF17704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17704_low_35 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 217
Target Start/End: Original strand, 51457779 - 51457987
Alignment:
| Q |
9 |
accctcctgctaatgcccctgctgttaatacacttgttgttccgacaaaccctccattgcataccattgtacctgctaaacccccaactcccaaccatca |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51457779 |
accctcctgctcatgcccctgctgttaatacacttgttgttccgacaaaccctccattgcatacaattgtaccttctaaacccccaactcccaaccatca |
51457878 |
T |
 |
| Q |
109 |
tcaccctccagctcctgcccgtgttcgcacacctgttgttccaactcacccacaattgcatcccactccttgccctagaagcttcaatgttgttcaaggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51457879 |
tcaccctccagctcctgcccgtgttcgcacacctgttgttccaactcacccacaattgcatcccactccttgccctagaagcttcaatgttgttcaaggt |
51457978 |
T |
 |
| Q |
209 |
attgttcat |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
51457979 |
attgttcat |
51457987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University