View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17705_low_19 (Length: 262)
Name: NF17705_low_19
Description: NF17705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17705_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 185 - 245
Target Start/End: Complemental strand, 6946223 - 6946163
Alignment:
| Q |
185 |
atttcgcagccaacatgacaaggatattgagatacaaccaagacgactcaacaatgcaatt |
245 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6946223 |
atttcgcagccaacatgataaggatattgagatacaaccaagacgactcaacaatgcaatt |
6946163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University