View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17705_low_22 (Length: 249)
Name: NF17705_low_22
Description: NF17705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17705_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 145 - 240
Target Start/End: Complemental strand, 4071786 - 4071691
Alignment:
| Q |
145 |
ttgtttgttccacaagcaaggtgcaattttccctgaaatttcaaatgcccttgttttcaatttgtcctcatcatcttcttctgtgaaatccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4071786 |
ttgtttgttccacaagcaaggtgcaattttccctgaaatttcaaatgcccttgttttcaatttgtcctcatcatcttcttctgtgaaatccctttg |
4071691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 4071930 - 4071901
Alignment:
| Q |
1 |
ttatcaacggatcttacacatattcagttg |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4071930 |
ttatcaacggatcttacacatattcagttg |
4071901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University